Top » Catalog » SNPs » Y3

$18.00

Y3
[Y3]

Y3
hg38 Position: ChrY:15689178..15689178
Ancestral: T
Derived: C
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b2a (not listed)
Comments: Found from public sources aka F2597. Below Z94 and above L657.
Forward Primer: Y3_F CAACGATGTCAGAAGAAACAGC
Reverse Primer: Y3_R TGCATACCACAAGGGAAAAG
Reviews

Customers who bought this product also purchased
Y9
Y9
CTS2887
CTS2887
Z2124
Z2124
YP294
YP294
R1a-Z93 Panel
R1a-Z93 Panel
Y39
Y39
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies