Top » Catalog » SNPs » A782

$18.00

A782
[A782]

A782
hg38 Position: ChrY:13410306..13410306
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: E1b1b1a1b1a6 (not listed)
Comments: Downstream V13 > L540 > A779
Forward Primer: A782_F TGAACTTGAGGGAGGTTTGG
Reverse Primer: A782_R CTTTTGGACTGCCAGTTGC
Reviews

Customers who bought this product also purchased
A779
A779
A781
A781
A780
A780
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies