Top » Catalog » SNPs » M2398

$18.00

M2398
[M2398]

M2398
hg38 Position: ChrY:8171664..8171664
Ancestral: T
Derived: C
Reference: Underhill et al.
ISOGG Haplogroup: L1a2a
Comments: Below L1307
Forward Primer: M2398_F GTGTTGGATAATTCAGGAGTTAGC
Reverse Primer: M2398_R GTGGTGTTTGTGGCAGCAC
Reviews

Customers who bought this product also purchased
L1307
L1307
BY199399
BY199399
L-M20 Panel
L-M20 Panel
Y44848
Y44848
M2667
M2667
Y6288
Y6288
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies