Top » Catalog » SNPs » M2398

$18.00

M2398
[M2398]

M2398
hg38 Position: ChrY:8171664..8171664
Ancestral: T
Derived: C
Reference: Underhill et al.
ISOGG Haplogroup: L1a2a
Comments: Below L1307
Forward Primer: M2398_F GTGTTGGATAATTCAGGAGTTAGC
Reverse Primer: M2398_R GTGGTGTTTGTGGCAGCAC
Reviews

Customers who bought this product also purchased
Y154689
Y154689
M2509
M2509
Y6253
Y6253
L1321
L1321
M2667
M2667
Y6288
Y6288
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies