Top » Catalog » SNPs » Y6288

$18.00

Y6288
[Y6288]

Y6288
hg38 Position: ChrY:19193949..19193949
Ancestral: G
Derived: C
Reference: Yfull (2014)
ISOGG Haplogroup: L1a2b~
Comments: Below L1307; aka FGC32285
Forward Primer: Y6288_F CACCATCTGAACACTTACACACTG
Reverse Primer: Y6288_R TCCATCTTTGTGTCCAATGAG
Reviews

Customers who bought this product also purchased
Z5919
Z5919
L1307
L1307
BY199399
BY199399
L-M20 Panel
L-M20 Panel
Y44848
Y44848
M2398
M2398
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies