Top » Catalog » SNPs » YFS2120222

$18.00

YFS2120222
[YFS2120222]

YFS2120222
hg38 Position: ChrY:12356411..12356411
Ancestral: G
Derived: C
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: YFS2120222_F GCGTGAGGAGCCATGAG
Reverse Primer: YFS2120222_R GGGCACTTATCAGTGCTTGTAAG
Reviews

Customers who bought this product also purchased
A17821
A17821
A17823
A17823
BY18204
BY18204
R1b-S603 OHare Panel
R1b-S603 OHare Panel
A17819
A17819
A17820
A17820
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies