Top » Catalog » SNPs » A787

$18.00

A787
[A787]

A787
hg38 Position: ChrY:3844746..3844746
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Below DF27
Forward Primer: A787_F AAGCGTAAACGGCAAACAAG
Reverse Primer: A787_R GATGGTTCTTTTGGGAGGTTC
Reviews

Customers who bought this product also purchased
A449
A449
A5581
A5581
A436
A436
A447
A447
A5579
A5579
A435
A435
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies