Top » Catalog » SNPs » A16413

$18.00

A16413
[A16413]

A16413
hg38 Position: ChrY:8879462..8879462
Ancestral: G
Derived: C
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2a
Comments: Parallel to I-A1221 and I-PH3414
Forward Primer: A16413_F TCCTTTAAATCCCAGAGTTTGC
Reverse Primer: A16413_R TGGCTGATGAACATCCAAAG
Reviews

Customers who bought this product also purchased
Y4460
Y4460
S17250
S17250
CTS10228
CTS10228
PH3414
PH3414
I2a-M423 Panel
I2a-M423 Panel
Z17855
Z17855
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies