Top » Catalog » SNPs » A16413

$18.00

A16413
[A16413]

A16413
hg38 Position: ChrY:8879462..8879462
Ancestral: G
Derived: C
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2a
Comments: Parallel to I-A1221 and I-PH3414
Forward Primer: A16413_F TCCTTTAAATCCCAGAGTTTGC
Reverse Primer: A16413_R TGGCTGATGAACATCCAAAG
Reviews

Customers who bought this product also purchased
Y230195
Y230195
BY99606
BY99606
Y18331
Y18331
Z2582
Z2582
L161.1
L161.1
BY118217
BY118217
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies