Top » Catalog » SNPs » A790

$18.00

A790
[A790]

A790
hg38 Position: ChrY:19822007..19822007
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Below DF27
Forward Primer: A790_F AAGTTAACAGCACAATGTCAAGATC
Reverse Primer: A790_R CAGACTCCTCAGTAGCTGGGAC
Reviews

Customers who bought this product also purchased
A10951
A10951
A455
A455
A445
A445
R1b-DF27 Rucker Panel
R1b-DF27 Rucker Panel
A451
A451
A436
A436
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies