Top » Catalog » SNPs » A16449

$18.00

A16449
[A16449]

A16449
hg38 Position: ChrY:7727872..7727872
Ancestral: G
Derived: A
Reference: John OGrady (2017)
ISOGG Haplogroup: I2
Comments: downstream of A1513 A1514
Forward Primer: A16449_F CTCACAGAAGGCAGGAGGTC
Reverse Primer: A16449_R CTCATTGGAGCCCTTCTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies