Top » Catalog » SNPs » HU397

$18.00

HU397
[HU397]

HU397
HG19 Position: ChrY:13125467..13125467
Ancestral: A
Derived: T
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: downstream ZS1820
Forward Primer: HU397_F TGAGATCAGCTCGATCATGG
Reverse Primer: HU397_R TGGAGTAGGGCAAGGAACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies