Top » Catalog » SNPs » HU397

$18.00

HU397
[HU397]

HU397
hg38 Position: ChrY:13125467..13125467
Ancestral: A
Derived: T
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: downstream ZS1820
Forward Primer: HU397_F TGAGATCAGCTCGATCATGG
Reverse Primer: HU397_R TGGAGTAGGGCAAGGAACAC
Reviews

Customers who bought this product also purchased
A19271
A19271
HU400
HU400
A19277
A19277
HU405
HU405
FGC64421
FGC64421
A19263
A19263
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies