Top » Catalog » SNPs » HU399

$18.00

HU399
[HU399]

HU399
hg38 Position: ChrY:15986837..15986837
Ancestral: G
Derived: C
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS1820
Forward Primer: HU399_F CAAAGACAATTTTGCTGGTGTG
Reverse Primer: HU399_R ACACGGTGAAACCCAGTCTC
Reviews

Customers who bought this product also purchased
HU397
HU397
A19269
A19269
HU403
HU403
A19275
A19275
HU408
HU408
A19280
A19280
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies