Top » Catalog » SNPs » HU399

$18.00

HU399
[HU399]

HU399
hg38 Position: ChrY:15986837..15986837
Ancestral: G
Derived: C
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS1820
Forward Primer: HU399_F CAAAGACAATTTTGCTGGTGTG
Reverse Primer: HU399_R ACACGGTGAAACCCAGTCTC
Reviews

Customers who bought this product also purchased
A19264
A19264
FGC64425
FGC64425
HU400
HU400
A19271
A19271
HU405
HU405
A19277
A19277
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies