Top » Catalog » SNPs » HU400

$18.00

HU400
[HU400]

HU400
hg38 Position: ChrY:20808173..20808173
Ancestral: C
Derived: T
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS1820
Forward Primer: HU400v2_F GATTGAAGGTATTATCTGGAAAACAG
Reverse Primer: HU400v2_R TGGAGTGCAGTGGCAGG
Reviews

Customers who bought this product also purchased
Whole Genome Sequence 45 GBases
Whole Genome Sequence 45 GBases
A22924
A22924
Y154841
Y154841
A22925
A22925
HU407
HU407
A19279
A19279
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
2 x BY33078
2 x BY98896
1 x FGC6745
$90.00
Haplogroup Info
Other products
Currencies