Top » Catalog » SNPs » HU400

$18.00

HU400
[HU400]

HU400
hg38 Position: ChrY:20808173..20808173
Ancestral: C
Derived: T
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS1820
Forward Primer: HU400_F GATAGCCTCCTGCCATGTTG
Reverse Primer: HU400_R GAGTGCAGTGGCAGGATCTC
Reviews

Customers who bought this product also purchased
HU404
HU404
A19277
A19277
A19263
A19263
FGC64421
FGC64421
HU397
HU397
A19270
A19270
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies