Top » Catalog » SNPs » HU400

$18.00

HU400
[HU400]

HU400
hg38 Position: ChrY:20808173..20808173
Ancestral: C
Derived: T
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS1820
Forward Primer: HU400_F GATAGCCTCCTGCCATGTTG
Reverse Primer: HU400_R GAGTGCAGTGGCAGGATCTC
Reviews

Customers who bought this product also purchased
HU409
HU409
A19281
A19281
J1a-ZS1820 Zhibian Panel
J1a-ZS1820 Zhibian Panel
A19269
A19269
HU402
HU402
A19275
A19275
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies