Top » Catalog » SNPs » HU400

$18.00

HU400
[HU400]

HU400
hg38 Position: ChrY:20808173..20808173
Ancestral: C
Derived: T
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS1820
Forward Primer: HU400_F GATAGCCTCCTGCCATGTTG
Reverse Primer: HU400_R GAGTGCAGTGGCAGGATCTC
Reviews

Customers who bought this product also purchased
HU407
HU407
A19279
A19279
A19265
A19265
HU399
HU399
A19272
A19272
HU406
HU406
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies