Top » Catalog » SNPs » HU401

$18.00

HU401
[HU401]

HU401
hg38 Position: ChrY:21109210..21109210
Ancestral: A
Derived: C
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS1820
Forward Primer: HU401_F ATGATGGGCAGTTCGTTTG
Reverse Primer: HU401_R TCTTTAGAAGGGCCACGATG
Reviews

Customers who bought this product also purchased
A22925
A22925
Whole Genome Sequence 45 GBases
Whole Genome Sequence 45 GBases
A22924
A22924
Y154841
Y154841
HU408
HU408
A19280
A19280
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies