Top » Catalog » SNPs » HU401

$18.00

HU401
[HU401]

HU401
hg38 Position: ChrY:21109210..21109210
Ancestral: A
Derived: C
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS1820
Forward Primer: HU401_F ATGATGGGCAGTTCGTTTG
Reverse Primer: HU401_R TCTTTAGAAGGGCCACGATG
Reviews

Customers who bought this product also purchased
HU407
HU407
A19279
A19279
J1a-ZS1820 Zhibian Panel
J1a-ZS1820 Zhibian Panel
A19265
A19265
HU400
HU400
A19272
A19272
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PF6901
1 x BY133
$36.00
Haplogroup Info
Other products
Currencies