Top » Catalog » SNPs » HU402

$18.00

HU402
[HU402]

HU402
hg38 Position: ChrY:21429960..21429960
Ancestral: A
Derived: G
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS1820
Forward Primer: HU402_F GGTTGGGGTGGTGTTTAGTG
Reverse Primer: HU402_R CCGGAACATTCTACTTGAAGC
Reviews

Customers who bought this product also purchased
A22919
A22919
A22918
A22918
Y154840
Y154840
Wish a SNP
Wish a SNP
A19266
A19266
HU401
HU401
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies