Top » Catalog » SNPs » HU402

$18.00

HU402
[HU402]

HU402
hg38 Position: ChrY:21429960..21429960
Ancestral: A
Derived: G
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS1820
Forward Primer: HU402_F GGTTGGGGTGGTGTTTAGTG
Reverse Primer: HU402_R CCGGAACATTCTACTTGAAGC
Reviews

Customers who bought this product also purchased
Y154840
Y154840
A22919
A22919
A22918
A22918
HU409
HU409
A19281
A19281
HU397
HU397
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies