Top » Catalog » SNPs » HU403

$18.00

HU403
[HU403]

HU403
hg38 Position: ChrY:21850268..21850268
Ancestral: C
Derived: T
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS1820
Forward Primer: HU403_F AGGTGGAGGTGGTCATTCTG
Reverse Primer: HU403_R TGGTGCAGCAGTTATTGAGC
Reviews

Customers who bought this product also purchased
A22924
A22924
Y154841
Y154841
A22925
A22925
Whole Genome Sequence 45 GBases
Whole Genome Sequence 45 GBases
HU398
HU398
A19270
A19270
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies