Top » Catalog » SNPs » HU403

$18.00

HU403
[HU403]

HU403
hg38 Position: ChrY:21850268..21850268
Ancestral: C
Derived: T
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS1820
Forward Primer: HU403_F AGGTGGAGGTGGTCATTCTG
Reverse Primer: HU403_R TGGTGCAGCAGTTATTGAGC
Reviews

Customers who bought this product also purchased
A22925
A22925
Whole Genome Sequence 45 GBases
Whole Genome Sequence 45 GBases
A22924
A22924
Y154841
Y154841
Wish a SNP
Wish a SNP
A19266
A19266
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies