Top » Catalog » SNPs » HU404

$18.00

HU404
[HU404]

HU404
hg38 Position: ChrY:2866983..2866983
Ancestral: A
Derived: G
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS1820
Forward Primer: HU404_F TTGCAGGGCAATAAACCTTG
Reverse Primer: HU404_R CCATCTCCCATAGCTTCCAC
Reviews

Customers who bought this product also purchased
Y154840
Y154840
A22919
A22919
A22918
A22918
HU406
HU406
A19278
A19278
A19264
A19264
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies