Top » Catalog » SNPs » HU405

$18.00

HU405
[HU405]

HU405
hg38 Position: ChrY:3025620..3025620
Ancestral: T
Derived: G
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS1820
Forward Primer: HU405_F CACCCACAATGTTCATATTATTCG
Reverse Primer: HU405_R TTCATGCAATGCAGCAAAAG
Reviews

Customers who bought this product also purchased
A19266
A19266
HU401
HU401
A19274
A19274
HU407
HU407
A19279
A19279
A19265
A19265
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies