Top » Catalog » SNPs » HU405

$18.00

HU405
[HU405]

HU405
hg38 Position: ChrY:3025620..3025620
Ancestral: T
Derived: G
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS1820
Forward Primer: HU405_F CACCCACAATGTTCATATTATTCG
Reverse Primer: HU405_R TTCATGCAATGCAGCAAAAG
Reviews

Customers who bought this product also purchased
A19264
A19264
FGC64425
FGC64425
HU398
HU398
A19271
A19271
HU404
HU404
A19277
A19277
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies