Top » Catalog » SNPs » HU405

$18.00

HU405
[HU405]

HU405
hg38 Position: ChrY:3025620..3025620
Ancestral: T
Derived: G
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS1820
Forward Primer: HU405_F CACCCACAATGTTCATATTATTCG
Reverse Primer: HU405_R TTCATGCAATGCAGCAAAAG
Reviews

Customers who bought this product also purchased
HU397
HU397
A19270
A19270
HU403
HU403
A19276
A19276
HU409
HU409
A19281
A19281
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies