Top » Catalog » SNPs » HU405

$18.00

HU405
[HU405]

HU405
hg38 Position: ChrY:3025620..3025620
Ancestral: T
Derived: G
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS1820
Forward Primer: HU405_F CACCCACAATGTTCATATTATTCG
Reverse Primer: HU405_R TTCATGCAATGCAGCAAAAG
Reviews

Customers who bought this product also purchased
HU400
HU400
Wish a SNP
Wish a SNP
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies