Top » Catalog » SNPs » ZS11519

$18.00

ZS11519
[ZS11519]

ZS11519
hg38 Position: ChrY:19977286..19977286
Ancestral: A
Derived: G
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC5
Forward Primer: ZS11519_F TCTAACTGCCTTGCTGATGC
Reverse Primer: ZS11519_R CAAAACAGCAAGCACGAATC
Reviews

Customers who bought this product also purchased
FGC4290
FGC4290
L858
L858
FGC44938
FGC44938
FGC7
FGC7
FGC1707
FGC1707
FGC2
FGC2
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies