Top » Catalog » SNPs » Z34364

$18.00

Z34364
[Z34364]

Z34364
hg38 Position: ChrY:15375700..15375700
Ancestral: C
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: D1a2a1b~
Comments: subgrp under M533
Forward Primer: Z34364_F AGCAGCTAGACTGACCAAGG
Reverse Primer: Z34364_R CATGCTTCAAGGACTGATTGC
Reviews

Customers who bought this product also purchased
Z34359
Z34359
CTS1828
CTS1828
M533
M533
M174
M174
Z34227
Z34227
D-M174 Panel
D-M174 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies