Top » Catalog » SNPs » Z34364

$18.00

Z34364
[Z34364]

Z34364
hg38 Position: ChrY:15375700..15375700
Ancestral: C
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: D1a2a1b~
Comments: subgrp under M533
Forward Primer: Z34364_F AGCAGCTAGACTGACCAAGG
Reverse Primer: Z34364_R CATGCTTCAAGGACTGATTGC
Reviews

Customers who bought this product also purchased
Z34359
Z34359
CTS1828
CTS1828
M533
M533
Y148136
Y148136
M174
M174
Z34227
Z34227
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies