Top » Catalog » SNPs » CTS6609

$18.00

CTS6609
[CTS6609]

CTS6609
hg38 Position: ChrY:14896817..14896817
Ancestral: A
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: D1b1c
Comments: Extracted from 1000 genomes data. Not qualified. Below M116.1
Forward Primer: CTS6609_F GGGGCAAAGAGCACTGAC
Reverse Primer: CTS6609_R AATGGCTTTCAAGGAACAAGTG
Reviews

Customers who bought this product also purchased
CTS107
CTS107
M125
M125
CTS8532
CTS8532
CTS8093
CTS8093
Z3611
Z3611
CTS2728
CTS2728
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies