Top » Catalog » SNPs » FGC22751

$18.00

FGC22751
[FGC22751]

FGC22751
HG19 Position: ChrY:16512120..16512125
Ancestral: ins
Derived: del
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream FGC5 > FGC1 > FGC7393 > CTS9501
Forward Primer: FGC22751_F ACTCGGAAAACCATGTCTGC
Reverse Primer: FGC22751_R GCAGAGGTTGCAGTGAGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies