Top » Catalog » SNPs » ZS1824

$18.00

ZS1824
[ZS1824]

ZS1824
hg38 Position: ChrY:19353120..19353120
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y sample M7040; approximate to CTS9501 aka FGC14703
Forward Primer: ZS1824_F CACAGGACTCACCAAAGTGG
Reverse Primer: ZS1824_R AAAATATACTTGAAAACTATGCGTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies