Top » Catalog » SNPs » ZS1824

$16.00

ZS1824
[ZS1824]

ZS1824
HG19 Position: ChrY:21515006..21515006
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y sample M7040; approximate to CTS9501 aka FGC14703
Forward Primer: ZS1824_F CACAGGACTCACCAAAGTGG
Reverse Primer: ZS1824_R AAAATATACTTGAAAACTATGCGTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10313
1 x A10159
1 x A10314
1 x A10294
1 x A10119
1 x A10242
1 x A10241
1 x A1001
1 x A10245
1 x A10152
1 x A10132
1 x A10027
1 x A10295
1 x A1011
1 x A1020
1 x A10138
1 x A1
1 x A10291
1 x A100
1 x A10330
1 x A10122
1 x A10318
1 x A10234
1 x A10218
1 x A10243
1 x A10287
1 x A10301
1 x A10296
1 x A10319
1 x A10300
1 x A10317
1 x A10233
1 x A10133
1 x A10023
$544.00
Haplogroup Info
Other products
Currencies