Top » Catalog » SNPs » Y29075

$18.00

Y29075
[Y29075]

Y29075
HG19 Position: ChrY:16598299..16598299
Ancestral: T
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y29075_F GCTGTAGTGCTTGGTTCAGTAGC
Reverse Primer: Y29075_R AAATTGCTGCGACCGTAGATAC
Reviews

Customers who bought this product also purchased
Wish a Panel
Wish a Panel
Y29077
Y29077
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies