Top » Catalog » SNPs » Y29077

$18.00

Y29077
[Y29077]

Y29077
HG19 Position: ChrY:6990318..6990318
Ancestral: A
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y29077_F GTTCCACTAATGGGAGATTGATG
Reverse Primer: Y29077_R GCCAGTTCAGTTCCATGATG
Reviews

Customers who bought this product also purchased
Y29075
Y29075
Wish a Panel
Wish a Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies