Top » Catalog » SNPs » A16534

$18.00

A16534
[A16534]

A16534
HG19 Position: ChrY:7444378..7444378
Ancestral: C
Derived: T
Reference: FGC20747 Administrators (2017)
ISOGG Haplogroup: R1b
Comments: Below A14368
Forward Primer: A16534_F CTAATTAAAGAATACCAATGTGCCCTAC
Reverse Primer: A16534_R CAGGACGAGGAGCTGGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies