Top » Catalog » SNPs » A16633

$18.00

A16633
[A16633]

A16633
hg38 Position: ChrY:20927392..20927392
Ancestral: G
Derived: T
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below CTS10936
Forward Primer: A16633_F CACAGATGGGCAGCATGG
Reverse Primer: A16633_R CTGTTCAGGAAACAACATGGAG
Reviews

Customers who bought this product also purchased
L161.1
L161.1
FGC20479
FGC20479
I2a-M423 Panel
I2a-M423 Panel
F3145
F3145
S2679
S2679
S17250
S17250
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies