Top » Catalog » SNPs » FGC40709

$18.00

FGC40709
[FGC40709]

FGC40709
hg38 Position: ChrY:5721337..5721337
Ancestral: G
Derived: A
Reference: Full Gnomes Corp (2015)
ISOGG Haplogroup: J1a
Comments: Below FGC1707 > FGC1713
Forward Primer: FGC40709_F CTGTCTGCTAAAAAGCAGGGTTATAC
Reverse Primer: FGC40709_R CTCAGCAGTCTGATACAATCAAATG
Reviews

Customers who bought this product also purchased
J1-FGC1713 Panel
J1-FGC1713 Panel
Y16746
Y16746
HU175
HU175
ZS9697
ZS9697
ZS9588
ZS9588
ZS7288
ZS7288
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies