Top » Catalog » SNPs » FGC40709

$18.00

FGC40709
[FGC40709]

FGC40709
hg38 Position: ChrY:5721337..5721337
Ancestral: G
Derived: A
Reference: Full Gnomes Corp (2015)
ISOGG Haplogroup: J1a
Comments: Note: 99.1% X, no warranty
Forward Primer: FGC40709_F CTGTCTGCTAAAAAGCAGGGTTATAC
Reverse Primer: FGC40709_R CTCAGCAGTCTGATACAATCAAATG
Reviews

Customers who bought this product also purchased
M168
M168
ZS7282
ZS7282
FT77163
FT77163
ZS5804
ZS5804
FGC4371
FGC4371
FT196050
FT196050
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies