Top » Catalog » SNPs » FGC40709

$18.00

FGC40709
[FGC40709]

FGC40709
hg38 Position: ChrY:5721337..5721337
Ancestral: G
Derived: A
Reference: Full Gnomes Corp (2015)
ISOGG Haplogroup: J1a
Comments: Below FGC1707 > FGC1713
Forward Primer: FGC40709_F CTGTCTGCTAAAAAGCAGGGTTATAC
Reverse Primer: FGC40709_R CTCAGCAGTCTGATACAATCAAATG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
FT135012
FT135012
A27137
A27137
A27224
A27224
ZS5806
ZS5806
FTA35962
FTA35962
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies