Top » Catalog » SNPs » BY145

$18.00

BY145
[BY145]

BY145
hg38 Position: ChrY:11713650..11713650
Ancestral: C
Derived: T
Reference: FTDNA (2014)
ISOGG Haplogroup: J1a2b2a~
Comments: Aka Z18223. GGAAT repeat region. No warranty
Forward Primer: BY145_F GGAATCGAAAGGAATGTAATCCT
Reverse Primer: BY145_R CATTCCATTCCATTCTATTCAATATC
Reviews

Customers who bought this product also purchased
ZS7094
ZS7094
FGC11
FGC11
ZS7091
ZS7091
FGC4480
FGC4480
FGC7
FGC7
FGC5
FGC5
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies