Top » Catalog » SNPs » BY145

$18.00

BY145
[BY145]

BY145
HG19 Position: ChrY:13834356..13834356
Ancestral: C
Derived: T
Reference: FTDNA (2014)
ISOGG Haplogroup: J1a2b2a~
Comments: Aka Z18223. GGAAT repeat region. No warranty
Forward Primer: BY145_F GGAATCGAAAGGAATGTAATCCT
Reverse Primer: BY145_R CATTCCATTCCATTCTATTCAATATC
Reviews

Customers who bought this product also purchased
FGC4480
FGC4480
ZS7091
ZS7091
FGC5
FGC5
FGC1721
FGC1721
ZS12046
ZS12046
ZS7564
ZS7564
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies