Top » Catalog » SNPs » BY145

$18.00

BY145
[BY145]

BY145
hg38 Position: ChrY:11713650..11713650
Ancestral: C
Derived: T
Reference: FTDNA (2014)
ISOGG Haplogroup: J1a2b2a~
Comments: Aka Z18223. GGAAT repeat region. No warranty
Forward Primer: BY145_F GGAATCGAAAGGAATGTAATCCT
Reverse Primer: BY145_R CATTCCATTCCATTCTATTCAATATC
Reviews

Customers who bought this product also purchased
FGC22259
FGC22259
FGC48180
FGC48180
FGC5424
FGC5424
FGC33172
FGC33172
FGC1707
FGC1707
FGC5432
FGC5432
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies