Top » Catalog » SNPs » BY145

$18.00

BY145
[BY145]

BY145
hg38 Position: ChrY:11713650..11713650
Ancestral: C
Derived: T
Reference: FTDNA (2014)
ISOGG Haplogroup: J1a2b2a~
Comments: Aka Z18223. GGAAT repeat region. No warranty
Forward Primer: BY145_F GGAATCGAAAGGAATGTAATCCT
Reverse Primer: BY145_R CATTCCATTCCATTCTATTCAATATC
Reviews

Customers who bought this product also purchased
J1-FGC5 Panel
J1-FGC5 Panel
FGC43127
FGC43127
Y163840
Y163840
FGC43122
FGC43122
FT244623
FT244623
ZS5010
ZS5010
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies