Top » Catalog » SNPs » BY145

$18.00

BY145
[BY145]

BY145
hg38 Position: ChrY:11713650..11713650
Ancestral: C
Derived: T
Reference: FTDNA (2014)
ISOGG Haplogroup: J1a2b2a~
Comments: Aka Z18223. GGAAT repeat region. No warranty
Forward Primer: BY145_F GGAATCGAAAGGAATGTAATCCT
Reverse Primer: BY145_R CATTCCATTCCATTCTATTCAATATC
Reviews

Customers who bought this product also purchased
FGC43127
FGC43127
Y163840
Y163840
FGC43122
FGC43122
FT244623
FT244623
ZS5010
ZS5010
ZS10488
ZS10488
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies