Top » Catalog » SNPs » FGC54410

$18.00

FGC54410
[FGC54410]

FGC54410
HG19 Position: ChrY:7776112..7776112
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC54410_F CTGCATTCTCTCTTTAAACTGTAGCAC
Reverse Primer: FGC54410_R GAGGTTTCCTAGCGTCCTGC
Reviews

Customers who bought this product also purchased
FGC49889
FGC49889
ZS11253
ZS11253
J1-M267 Superclade Panel
J1-M267 Superclade Panel
ZS11519
ZS11519
FGC1
FGC1
ZS10488
ZS10488
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies