Top » Catalog » SNPs » ZS5804

$18.00

ZS5804
[ZS5804]

ZS5804
hg38 Position: ChrY:10030755..10030755
Ancestral: T
Derived: G
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC1713. 97% Y no warranty Aka FGC23914
Forward Primer: ZS5804_F AAGAAGCTGGTGGTCTCCGT
Reverse Primer: ZS5804_R GTGATGTGAATACAAAGATGAAGTGC
Reviews

Customers who bought this product also purchased
ZS5809
ZS5809
ZS4753
ZS4753
FGC4316
FGC4316
FGC11723
FGC11723
Z20777
Z20777
FGC58383
FGC58383
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies