Top » Catalog » SNPs » ZS5804

$18.00

ZS5804
[ZS5804]

ZS5804
hg38 Position: ChrY:10030755..10030755
Ancestral: T
Derived: G
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC1713. 97% Y no warranty Aka FGC23914
Forward Primer: ZS5804_F AAGAAGCTGGTGGTCTCCGT
Reverse Primer: ZS5804_R GTGATGTGAATACAAAGATGAAGTGC
Reviews

Customers who bought this product also purchased
FGC15177
FGC15177
FT50816
FT50816
L1303
L1303
Y171687
Y171687
BY2
BY2
BY189399
BY189399
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies