Top » Catalog » SNPs » ZS5804

$18.00

ZS5804
[ZS5804]

ZS5804
hg38 Position: ChrY:10030755..10030755
Ancestral: T
Derived: G
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC1713. 97% Y no warranty Aka FGC23914
Forward Primer: ZS5804_F AAGAAGCTGGTGGTCTCCGT
Reverse Primer: ZS5804_R GTGATGTGAATACAAAGATGAAGTGC
Reviews

Customers who bought this product also purchased
FGC90953
FGC90953
Y85182
Y85182
ZS1862
ZS1862
M267
M267
FGC1712
FGC1712
BY78172
BY78172
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies