Top » Catalog » SNPs » ZS5804

$18.00

ZS5804
[ZS5804]

ZS5804
hg38 Position: ChrY:10030755..10030755
Ancestral: T
Derived: G
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC1713. 97% Y no warranty Aka FGC23914
Forward Primer: ZS5804_F AAGAAGCTGGTGGTCTCCGT
Reverse Primer: ZS5804_R GTGATGTGAATACAAAGATGAAGTGC
Reviews

Customers who bought this product also purchased
Y16746
Y16746
FGC5427
FGC5427
Y85182
Y85182
FGC90953
FGC90953
BY78172
BY78172
M96
M96
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies