Top » Catalog » SNPs » ZS5804

$18.00

ZS5804
[ZS5804]

ZS5804
hg38 Position: ChrY:10030755..10030755
Ancestral: T
Derived: G
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC1713. 97% Y no warranty Aka FGC23914
Forward Primer: ZS5804_F AAGAAGCTGGTGGTCTCCGT
Reverse Primer: ZS5804_R GTGATGTGAATACAAAGATGAAGTGC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
FGC34530
FGC34530
A19335
A19335
J1-FGC1713 Panel
J1-FGC1713 Panel
A27137
A27137
ZS5801
ZS5801
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies