Top » Catalog » SNPs » V2580

$18.00

V2580
[V2580]

V2580
hg38 Position: ChrY:12650972..12650972
Ancestral: A
Derived: G
Reference: Trombetta et al (2015)
ISOGG Haplogroup: E1b1a1a1a2a1a3b1d1c1
Comments: Aka CTS3243
Forward Primer: V2580_F GTTGGTGGTAGCCAAACAGC
Reverse Primer: V2580_R GTTGTACAACTCCCATGAATACAATATAC
Reviews

Customers who bought this product also purchased
M3907
M3907
E Superclade Panel
E Superclade Panel
Y65944
Y65944
M4231
M4231
Z1720
Z1720
M96
M96
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies