Top » Catalog » SNPs » FGC13109

$18.00

FGC13109
[FGC13109]

FGC13109
hg38 Position: ChrY:8360705..8360705
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Downstream DF27
Forward Primer: FGC13109_F CCATATCACCTACATGATATGTTCTG
Reverse Primer: FGC13109_R CTATGGCAAGCACCTGCA
Reviews

Customers who bought this product also purchased
FGC40704
FGC40704
Y16018
Y16018
BY15279
BY15279
CTS416
CTS416
Y12470
Y12470
Z2543
Z2543
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies