Top » Catalog » SNPs » CTS3274

$18.00

CTS3274
[CTS3274]

CTS3274
hg38 Position: ChrY:12674015..12674015
Ancestral: A
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b1a1a1a1c2c
Comments: Extracted from 1000 genomes data. Not qualified. Below L485
Forward Primer: CTS3274_F TGAAGTAATCTGCCTGCTTCG
Reverse Primer: CTS3274_R TTTTGTCCTAAAATAAGGTAACTGG
Reviews

Customers who bought this product also purchased
M253
M253
P115
P115
L485
L485
CTS9806
CTS9806
CTS4262
CTS4262
CTS9580
CTS9580
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies