Top » Catalog » SNPs » CTS3274

$18.00

CTS3274
[CTS3274]

CTS3274
hg38 Position: ChrY:12674015..12674015
Ancestral: A
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b1a1a1a1c2c
Comments: Extracted from 1000 genomes data. Not qualified. Below L485
Forward Primer: CTS3274_F TGAAGTAATCTGCCTGCTTCG
Reverse Primer: CTS3274_R TTTTGTCCTAAAATAAGGTAACTGG
Reviews

Customers who bought this product also purchased
M4689
M4689
CTS4625
CTS4625
Z1645
Z1645
CTS5788
CTS5788
Z22636
Z22636
CTS668
CTS668
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies